Alixoxo2089 Alixoxo2089
  • 02-04-2018
  • Social Studies
contestada

Who is the ordinary minister of the sacrament of confirmation in the western chruch? in the eastern church?

Respuesta :

BriM19
BriM19 BriM19
  • 12-04-2018
The difference between the Western and the Eastern Churches is that The Eastern Confirmation is done by the priest, and all sacraments under the sacrament of initiation is done one-after-another, while in the Western Church, the sacrament of confirmation is done by the bishop, and the other sacraments of initiation are done separately.
Answer Link

Otras preguntas

what is 0.00001267 is scientific notation
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Explain why applying a vertical translation and then a horizontal translation produces the same result as applying a horizonatal translation and then a vertical
How much money, in dollars, does one mole of nickels represent?
what is the lcd of 10/11,29/44
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
What is the difference between "Herr" and "Herrn"?
Why was wilson not able to finish his speaking tour
where are the three parts of an atom located