b5eckFranaha b5eckFranaha
  • 03-03-2017
  • History
contestada

If there had been a telegraph, the war of 1812 would probably not have started. true false

Respuesta :

BluSeaa
BluSeaa BluSeaa
  • 22-08-2019

The answer is false. Hope this helps!

Answer Link

Otras preguntas

A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites
what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
A generator stores electric current. Explain why you agree or disagree with this statement
How much money, in dollars, does one mole of nickels represent?
Explain who or what "Año Viejo" is and its significance.
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5