osbaldohernandez839 osbaldohernandez839
  • 03-11-2021
  • History
contestada

How would it extend the Great Depression

Respuesta :

diadolon3
diadolon3 diadolon3
  • 06-11-2021

The wartime economic boom reflected not only the enormous resource drain of military spending, but also the erosion of new Deal labor and industrial policies.

Answer Link

Otras preguntas

how can you write 0.45 as fraction and a percentage ,please show work
how do you know 8 thousandths is less than 1 hundredths
What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
what are 2 points on the graph for 6x-5y=25
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
A generator stores electric current. Explain why you agree or disagree with this statement
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung