Liverules
Liverules Liverules
  • 02-11-2021
  • Mathematics
contestada

What number is 3/4 of 65

Respuesta :

X3mommie
X3mommie X3mommie
  • 02-11-2021
48.75 is 3/4 of 65.
Answer Link

Otras preguntas

4 (2x-6)=10x-6. solve for x
What does Thomas Jefferson mean by Certain unalienable rights and the in the excerpt from the Declaration of Independence
Write each statement as an algebraic expression. Twice the difference of x and y divided by 5 times their product.
a triangle has a measure of 30. The other two angles are in a ratio of 7:8. What are the measures of those two angles?
Which tortoises, mainland or island, need to eat more food per gram of their body mass?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Find the equation, in point-slope form, of the line that passes -3 and passes through the point (1,2). plz show your work.
need help anybody know how to do this
Secured it means a lender gives you money in exchange for what?
The textbook defines _____ as a cluster of characteristics that are associated with all members of a specific social group, often including qualities that are u