pariso82 pariso82
  • 03-05-2021
  • Biology
contestada

Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
T-A-C-G-T-C-A-G-T-G-G|
2. You just wrote in the template strand of DNA. Use the template strand to transcribe a strand
of mRNA
mRNA

Respuesta :

clarareina04 clarareina04
  • 03-05-2021

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

Answer Link

Otras preguntas

the dwarf sea horse hippocampus zosterae swims at a rate of 52.68 feet per hour convert this speed to inches per minute.
National governments have more power than any other human institution in the world. Why do you think this is the case?
What is the missing Exponent? (2^-5)_______=2^-15
0.0072 in expanded form
3(2j-k) = 108, for j
I have 5 min. so please answer fast .An XBOX 360 regularly sells for $399. It is on sale for 20% off. What is the sale price of the XBOX 360? A)$78.80 B)$300.0
Why might a scientist need to repeat an experiment
Convert 74.69 to expanded form
why do you suppose the population of deer declined in 1925, although the elimination of predators?
There were 200 people at the baseball game. Each of them bought a $8 ticket to get into the game. How much money did the people spend on baseball tickets for th