creolebeauty79 creolebeauty79
  • 02-02-2021
  • Mathematics
contestada

Four times a number plus three times a second number is negative nine. Twice the first number plus the second number is three

Respuesta :

rorycampbell0721
rorycampbell0721 rorycampbell0721
  • 02-02-2021

Answer:

First number: 9

Second number: -15

Answer Link
wumipopo18
wumipopo18 wumipopo18
  • 02-02-2021

Answer:{4m+3n=-9

2m+n=3

Step-by-step explanation:

Ver imagen wumipopo18
Answer Link

Otras preguntas

Suppose the heights of 18-year-old men are approximately normally distributed, with mean 67 inches and standard deviation 5 inches. (a) what is the probability
The_____ form acidic compounds with hydrogen.
can you guys help me with this simple math problem ?
PLEASE HELP ME !!!!!!!!!! I BEG YOU !!!!!! PLEASE HAVE MERCY !!!!                           Use I = PRT to solve I = $350 P= $700           Find T (T
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
PLEASE HELP!! What was the 90-day wage and price freeze? A) a temporary freeze on wages, prices, and rents B) a sale to help the economy C) a
A _____ reaction is one that consists of two or more elementary reactions. a. simple b. complex c. single d. double
Which of the following can be a cause of social change?
What law required Northerners to assist in the return of runaway slaves
How do you find the length of the hypetnyuse if you have one angle and opposite side?