shakena9661 shakena9661
  • 01-02-2021
  • English
contestada

Help!! I’ll mark you the brainliest!! Questions 3&4 pleaseee

Help Ill mark you the brainliest Questions 3amp4 pleaseee class=

Respuesta :

agoniwicha
agoniwicha agoniwicha
  • 01-02-2021

Answer:

A-D

Explanation:

Answer Link
steff91 steff91
  • 01-02-2021
I believe it would be A ——————————— D
Answer Link

Otras preguntas

One of the most damaging problems of the carter administration was its failure to win the release of u.s. hostages from
Which order pair could be removed so that the set of ordered pairs is a function (4,-2) (-3,2) (3,4) (1,1)
help quick please!! Thanks
The term used when an organism is studied in its natural environment is
"which band was led by guitarist peter buck and vocalist michael stipe?"
HELP FAST!!!! Solve the compound inequality, showing your work. Name the solution set and then draw the graph of the solution set. x-3≤-7 or x-3≥1
Why is the epa considered to be one of the most powerful bureaucracies?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Find the length of a leg of an isosceles right triangle whose hypotenuse measures 8√2
If two populations are isolated, they may become separate species because they are not longer ________.