chris5282001 chris5282001

03-04-2019
English

contestada

What is the rhyme scheme established in these lines?

What is the rhyme scheme established in these lines class=

Respuesta :

starlipika starlipika

03-04-2019

c. ABA because the 1st and 3rd line rhyme

Answer Link

Otras preguntas

The table shows the height of a ball, h(t), after t seconds. The data can be modeled using a quadratic regression equation. Time (s) 1 2 3 4 Height (ft.) 88.7

1. у- 13 – 5х у - 5х = 12 What is the solution

How did slaves feel about the declaration of dependence ?

Can someone help me with this?

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Select the correct answer. Consider this absolute value function. f(x) = [ x + 3 ] If function f is written as a piecewise function, which piece will it incl

Solve |p+3|= 5. Graph the solution set.

Information about 1920 german economy

is it true or false that all whole numbers are natural numbers

The mean length of 9 childrens' big finger is 6.8cm. The mean length of 3 adults' big finger is 11cm. What is the mean length (rounded to 2 DP) of these 12 pe